Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA....
| Main Authors: | , , , |
|---|---|
| Format: | Conference or Workshop Item |
| Language: | English |
| Published: |
2009
|
| Online Access: | http://psasir.upm.edu.my/id/eprint/65140/ http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf |
| _version_ | 1848855203321741312 |
|---|---|
| author | Yow, Weng Kit Panandam, Jothi Malar Idris, Ismail Mohd Saleh, Norihan |
| author_facet | Yow, Weng Kit Panandam, Jothi Malar Idris, Ismail Mohd Saleh, Norihan |
| author_sort | Yow, Weng Kit |
| building | UPM Institutional Repository |
| collection | Online Access |
| description | The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA. The objective of this study was to evaluate the genetic variability in the mitochondrial D-loop region in the Kedah Kelantan cattle. DNA was extracted from the blood of 30 Kedah Kelantan cattle. The D-loop region was amplified using polymerase chain reaction (PCR) and the primers 5’ CCCAAAGCTGAAGTTCTATT 3’ (forward) and 5’ TTGGGTTAAGCTACATCAAC 3’ (reverse). The size of the amplified PCR product was 964 bp. The PCR product was then digested with six restriction endonucleases (RE): ApaI, BstXI, TaqI, BamHI, DdeI and HinfI. Three fragments were detected using Dde I and the rest of the RE produced two fragments each. No polymorphism was revealed for all six RE. The results indicated no variation in the D-loop region of the Kedah Kelantan cattle as far as these six RE were concerned. |
| first_indexed | 2025-11-15T11:22:02Z |
| format | Conference or Workshop Item |
| id | upm-65140 |
| institution | Universiti Putra Malaysia |
| institution_category | Local University |
| language | English |
| last_indexed | 2025-11-15T11:22:02Z |
| publishDate | 2009 |
| recordtype | eprints |
| repository_type | Digital Repository |
| spelling | upm-651402018-09-04T04:14:51Z http://psasir.upm.edu.my/id/eprint/65140/ Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle Yow, Weng Kit Panandam, Jothi Malar Idris, Ismail Mohd Saleh, Norihan The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA. The objective of this study was to evaluate the genetic variability in the mitochondrial D-loop region in the Kedah Kelantan cattle. DNA was extracted from the blood of 30 Kedah Kelantan cattle. The D-loop region was amplified using polymerase chain reaction (PCR) and the primers 5’ CCCAAAGCTGAAGTTCTATT 3’ (forward) and 5’ TTGGGTTAAGCTACATCAAC 3’ (reverse). The size of the amplified PCR product was 964 bp. The PCR product was then digested with six restriction endonucleases (RE): ApaI, BstXI, TaqI, BamHI, DdeI and HinfI. Three fragments were detected using Dde I and the rest of the RE produced two fragments each. No polymorphism was revealed for all six RE. The results indicated no variation in the D-loop region of the Kedah Kelantan cattle as far as these six RE were concerned. 2009 Conference or Workshop Item PeerReviewed text en http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf Yow, Weng Kit and Panandam, Jothi Malar and Idris, Ismail and Mohd Saleh, Norihan (2009) Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle. In: 8th Malaysia Congress on Genetics, 4-6 Aug. 2009, Genting Highlands, Malaysia. (pp. 342-344). |
| spellingShingle | Yow, Weng Kit Panandam, Jothi Malar Idris, Ismail Mohd Saleh, Norihan Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title | Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title_full | Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title_fullStr | Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title_full_unstemmed | Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title_short | Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle |
| title_sort | lack of variability in the mitochondrial dna d-loop region in kedah kelantan cattle |
| url | http://psasir.upm.edu.my/id/eprint/65140/ http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf |