Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle

The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA....

Full description

Bibliographic Details
Main Authors: Yow, Weng Kit, Panandam, Jothi Malar, Idris, Ismail, Mohd Saleh, Norihan
Format: Conference or Workshop Item
Language:English
Published: 2009
Online Access:http://psasir.upm.edu.my/id/eprint/65140/
http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf
_version_ 1848855203321741312
author Yow, Weng Kit
Panandam, Jothi Malar
Idris, Ismail
Mohd Saleh, Norihan
author_facet Yow, Weng Kit
Panandam, Jothi Malar
Idris, Ismail
Mohd Saleh, Norihan
author_sort Yow, Weng Kit
building UPM Institutional Repository
collection Online Access
description The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA. The objective of this study was to evaluate the genetic variability in the mitochondrial D-loop region in the Kedah Kelantan cattle. DNA was extracted from the blood of 30 Kedah Kelantan cattle. The D-loop region was amplified using polymerase chain reaction (PCR) and the primers 5’ CCCAAAGCTGAAGTTCTATT 3’ (forward) and 5’ TTGGGTTAAGCTACATCAAC 3’ (reverse). The size of the amplified PCR product was 964 bp. The PCR product was then digested with six restriction endonucleases (RE): ApaI, BstXI, TaqI, BamHI, DdeI and HinfI. Three fragments were detected using Dde I and the rest of the RE produced two fragments each. No polymorphism was revealed for all six RE. The results indicated no variation in the D-loop region of the Kedah Kelantan cattle as far as these six RE were concerned.
first_indexed 2025-11-15T11:22:02Z
format Conference or Workshop Item
id upm-65140
institution Universiti Putra Malaysia
institution_category Local University
language English
last_indexed 2025-11-15T11:22:02Z
publishDate 2009
recordtype eprints
repository_type Digital Repository
spelling upm-651402018-09-04T04:14:51Z http://psasir.upm.edu.my/id/eprint/65140/ Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle Yow, Weng Kit Panandam, Jothi Malar Idris, Ismail Mohd Saleh, Norihan The Kedah Kelantan, which is a Bos indicus breed, is the indigenous cattle of Malaysia. Mitochondrial DNA displacement loop (D-loop) region is often used to analyze the phylogeny of closely related breeds within species. Variations that occur in this region can be used as genetic markers for mtDNA. The objective of this study was to evaluate the genetic variability in the mitochondrial D-loop region in the Kedah Kelantan cattle. DNA was extracted from the blood of 30 Kedah Kelantan cattle. The D-loop region was amplified using polymerase chain reaction (PCR) and the primers 5’ CCCAAAGCTGAAGTTCTATT 3’ (forward) and 5’ TTGGGTTAAGCTACATCAAC 3’ (reverse). The size of the amplified PCR product was 964 bp. The PCR product was then digested with six restriction endonucleases (RE): ApaI, BstXI, TaqI, BamHI, DdeI and HinfI. Three fragments were detected using Dde I and the rest of the RE produced two fragments each. No polymorphism was revealed for all six RE. The results indicated no variation in the D-loop region of the Kedah Kelantan cattle as far as these six RE were concerned. 2009 Conference or Workshop Item PeerReviewed text en http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf Yow, Weng Kit and Panandam, Jothi Malar and Idris, Ismail and Mohd Saleh, Norihan (2009) Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle. In: 8th Malaysia Congress on Genetics, 4-6 Aug. 2009, Genting Highlands, Malaysia. (pp. 342-344).
spellingShingle Yow, Weng Kit
Panandam, Jothi Malar
Idris, Ismail
Mohd Saleh, Norihan
Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title_full Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title_fullStr Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title_full_unstemmed Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title_short Lack of variability in the mitochondrial DNA D-loop region in Kedah Kelantan cattle
title_sort lack of variability in the mitochondrial dna d-loop region in kedah kelantan cattle
url http://psasir.upm.edu.my/id/eprint/65140/
http://psasir.upm.edu.my/id/eprint/65140/1/PGM-1-21.pdf