Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected...
| Main Authors: | , , , , , , , , , |
|---|---|
| Format: | Article |
| Language: | English |
| Published: |
Karger AG, Basel
2015
|
| Subjects: | |
| Online Access: | http://ir.unimas.my/id/eprint/8402/ http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf |
| _version_ | 1848836369906925568 |
|---|---|
| author | Jin-Ai M.A., Tan Saw-Sian, Chin Gek-Bee, Ong Mohamed N., Mohamed Unni Ashley E.R., Soosay Henry R., Gudum Siew-Leng, Kho Kek-Heng, Chua Jang J., Chen Elizabeth, George |
| author_facet | Jin-Ai M.A., Tan Saw-Sian, Chin Gek-Bee, Ong Mohamed N., Mohamed Unni Ashley E.R., Soosay Henry R., Gudum Siew-Leng, Kho Kek-Heng, Chua Jang J., Chen Elizabeth, George |
| author_sort | Jin-Ai M.A., Tan |
| building | UNIMAS Institutional Repository |
| collection | Online Access |
| description | Background: Although thalassemia is a genetic hemoglobinopathy
in Malaysia, there is limited data on thalassemia mutations
in the indigenous groups. This study aims to identify
the types of globin gene mutations in transfusion-dependent
patients in Northern Sarawak. Methods: Blood was collected
from 32 patients from the Malay, Chinese, Kedayan, Bisayah,
Kadazandusun, Tagal, and Bugis populations. The α- and
β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2
previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia
alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and
Tagal patients. The β-globin gene mutations in the Chinese
patients were similar to the Chinese in West Malaysia. Hb Adana
(HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected
in 5 patients. A novel 24-bp deletion in the α2-globin gene
(HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG)
was identified by sequencing. Co-inheritance of α-thalassemia
with β-thalassemia did not ameliorate the severity of
thalassemia major in the patients. Conclusion: The Filipino
β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique
to the Malays in Sarawak. Genomic sequencing is an essential
tool to detect rare genetic variants in the study of new populations. |
| first_indexed | 2025-11-15T06:22:41Z |
| format | Article |
| id | unimas-8402 |
| institution | Universiti Malaysia Sarawak |
| institution_category | Local University |
| language | English |
| last_indexed | 2025-11-15T06:22:41Z |
| publishDate | 2015 |
| publisher | Karger AG, Basel |
| recordtype | eprints |
| repository_type | Digital Repository |
| spelling | unimas-84022017-02-06T07:47:45Z http://ir.unimas.my/id/eprint/8402/ Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations Jin-Ai M.A., Tan Saw-Sian, Chin Gek-Bee, Ong Mohamed N., Mohamed Unni Ashley E.R., Soosay Henry R., Gudum Siew-Leng, Kho Kek-Heng, Chua Jang J., Chen Elizabeth, George R Medicine (General) Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. Karger AG, Basel 2015 Article NonPeerReviewed text en http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf Jin-Ai M.A., Tan and Saw-Sian, Chin and Gek-Bee, Ong and Mohamed N., Mohamed Unni and Ashley E.R., Soosay and Henry R., Gudum and Siew-Leng, Kho and Kek-Heng, Chua and Jang J., Chen and Elizabeth, George (2015) Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations. Public Health Genomics, 18 (1). pp. 60-64. ISSN 1662-8063 http://www.researchgate.net/publication/268632267_Transfusion-Dependent_Thalassemia_in_Northern_Sarawak_A_Molecular_Study_to_Identify_Different_Genotypes_in_the_Multi-Ethnic_Groups_and_the_Importance_of_Genomic_Sequencing_in_Unstudied_Populations DOI:10.1159/000368342 |
| spellingShingle | R Medicine (General) Jin-Ai M.A., Tan Saw-Sian, Chin Gek-Bee, Ong Mohamed N., Mohamed Unni Ashley E.R., Soosay Henry R., Gudum Siew-Leng, Kho Kek-Heng, Chua Jang J., Chen Elizabeth, George Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title | Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title_full | Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title_fullStr | Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title_full_unstemmed | Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title_short | Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations |
| title_sort | transfusion-dependent thalassemia in northern sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations |
| topic | R Medicine (General) |
| url | http://ir.unimas.my/id/eprint/8402/ http://ir.unimas.my/id/eprint/8402/ http://ir.unimas.my/id/eprint/8402/ http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf |