Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations

Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected...

Full description

Bibliographic Details
Main Authors: Jin-Ai M.A., Tan, Saw-Sian, Chin, Gek-Bee, Ong, Mohamed N., Mohamed Unni, Ashley E.R., Soosay, Henry R., Gudum, Siew-Leng, Kho, Kek-Heng, Chua, Jang J., Chen, Elizabeth, George
Format: Article
Language:English
Published: Karger AG, Basel 2015
Subjects:
Online Access:http://ir.unimas.my/id/eprint/8402/
http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf
_version_ 1848836369906925568
author Jin-Ai M.A., Tan
Saw-Sian, Chin
Gek-Bee, Ong
Mohamed N., Mohamed Unni
Ashley E.R., Soosay
Henry R., Gudum
Siew-Leng, Kho
Kek-Heng, Chua
Jang J., Chen
Elizabeth, George
author_facet Jin-Ai M.A., Tan
Saw-Sian, Chin
Gek-Bee, Ong
Mohamed N., Mohamed Unni
Ashley E.R., Soosay
Henry R., Gudum
Siew-Leng, Kho
Kek-Heng, Chua
Jang J., Chen
Elizabeth, George
author_sort Jin-Ai M.A., Tan
building UNIMAS Institutional Repository
collection Online Access
description Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
first_indexed 2025-11-15T06:22:41Z
format Article
id unimas-8402
institution Universiti Malaysia Sarawak
institution_category Local University
language English
last_indexed 2025-11-15T06:22:41Z
publishDate 2015
publisher Karger AG, Basel
recordtype eprints
repository_type Digital Repository
spelling unimas-84022017-02-06T07:47:45Z http://ir.unimas.my/id/eprint/8402/ Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations Jin-Ai M.A., Tan Saw-Sian, Chin Gek-Bee, Ong Mohamed N., Mohamed Unni Ashley E.R., Soosay Henry R., Gudum Siew-Leng, Kho Kek-Heng, Chua Jang J., Chen Elizabeth, George R Medicine (General) Background: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Methods: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Results: Ten β- and 2 previously reported α-globin defects were identified. The Fil-ipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the –α 3.7 /αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. Conclusion: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. Karger AG, Basel 2015 Article NonPeerReviewed text en http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf Jin-Ai M.A., Tan and Saw-Sian, Chin and Gek-Bee, Ong and Mohamed N., Mohamed Unni and Ashley E.R., Soosay and Henry R., Gudum and Siew-Leng, Kho and Kek-Heng, Chua and Jang J., Chen and Elizabeth, George (2015) Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations. Public Health Genomics, 18 (1). pp. 60-64. ISSN 1662-8063 http://www.researchgate.net/publication/268632267_Transfusion-Dependent_Thalassemia_in_Northern_Sarawak_A_Molecular_Study_to_Identify_Different_Genotypes_in_the_Multi-Ethnic_Groups_and_the_Importance_of_Genomic_Sequencing_in_Unstudied_Populations DOI:10.1159/000368342
spellingShingle R Medicine (General)
Jin-Ai M.A., Tan
Saw-Sian, Chin
Gek-Bee, Ong
Mohamed N., Mohamed Unni
Ashley E.R., Soosay
Henry R., Gudum
Siew-Leng, Kho
Kek-Heng, Chua
Jang J., Chen
Elizabeth, George
Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title_full Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title_fullStr Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title_full_unstemmed Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title_short Transfusion-Dependent Thalassemia in Northern Sarawak: A Molecular Study to Identify Different Genotypes in the Multi-Ethnic Groups and the Importance of Genomic Sequencing in Unstudied Populations
title_sort transfusion-dependent thalassemia in northern sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
topic R Medicine (General)
url http://ir.unimas.my/id/eprint/8402/
http://ir.unimas.my/id/eprint/8402/
http://ir.unimas.my/id/eprint/8402/
http://ir.unimas.my/id/eprint/8402/1/NO%20140%20Transfusion-dependent%20Thalassemia%20in%20northern%20Sarawak%20-%20abstrak.pdf