Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR

Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a to...

Full description

Bibliographic Details
Main Author: Intan Syahirah, Amran
Format: Final Year Project Report / IMRAD
Language:English
Published: Universiti Malaysia Sarawak, (UNIMAS) 2016
Subjects:
Online Access:http://ir.unimas.my/id/eprint/15463/
http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf
_version_ 1848837858972925952
author Intan Syahirah, Amran
author_facet Intan Syahirah, Amran
author_sort Intan Syahirah, Amran
building UNIMAS Institutional Repository
collection Online Access
description Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a tool. A total of 70 samples were obtained from the culture collection in Microbiology Laboratory FRST, UNIMAS. The samples was cultured into semi solid EMJH media added with 5-fluorouracil. The cultures were incubated at room temperature (28-30°C) for 30 days before ERIC-PCR was conducted. This procedure was used a specific primer which is ERIC 1 (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) that targeting ERIC sequence. The ERIC elements were used as a genetic marker to characterize isolates within bacterial species. Though, by using PyElph 1.4 software to construct the phylogenetic tree to know the similarity coefficient levels and calculating by using DI (Diversity Indices'). From that, there are no proper arrangement of bacteria in the group regardless of samples type whether it mix together to 7 groups and also of Leptospira in different location and sources. In conclusion, genetic relatedness between Leptospira spp are studied and allow their characterization among the type of samples isolates.
first_indexed 2025-11-15T06:46:21Z
format Final Year Project Report / IMRAD
id unimas-15463
institution Universiti Malaysia Sarawak
institution_category Local University
language English
last_indexed 2025-11-15T06:46:21Z
publishDate 2016
publisher Universiti Malaysia Sarawak, (UNIMAS)
recordtype eprints
repository_type Digital Repository
spelling unimas-154632023-12-11T06:53:18Z http://ir.unimas.my/id/eprint/15463/ Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR Intan Syahirah, Amran QR Microbiology Leptospirosis is endemic to tropical regions of the world and is re-emerging as a new danger to public health in Southeast Asia, including Malaysia. The aim of this study was to evaluate molecular typing of Leptospira spp. by using Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) as a tool. A total of 70 samples were obtained from the culture collection in Microbiology Laboratory FRST, UNIMAS. The samples was cultured into semi solid EMJH media added with 5-fluorouracil. The cultures were incubated at room temperature (28-30°C) for 30 days before ERIC-PCR was conducted. This procedure was used a specific primer which is ERIC 1 (ATGTAAGCTCCTGGGGATTCAC) and ERIC2 (AAGTAAGTGACTGGGGTGAGCG) that targeting ERIC sequence. The ERIC elements were used as a genetic marker to characterize isolates within bacterial species. Though, by using PyElph 1.4 software to construct the phylogenetic tree to know the similarity coefficient levels and calculating by using DI (Diversity Indices'). From that, there are no proper arrangement of bacteria in the group regardless of samples type whether it mix together to 7 groups and also of Leptospira in different location and sources. In conclusion, genetic relatedness between Leptospira spp are studied and allow their characterization among the type of samples isolates. Universiti Malaysia Sarawak, (UNIMAS) 2016 Final Year Project Report / IMRAD NonPeerReviewed text en http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf Intan Syahirah, Amran (2016) Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR. [Final Year Project Report / IMRAD] (Unpublished)
spellingShingle QR Microbiology
Intan Syahirah, Amran
Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title_full Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title_fullStr Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title_full_unstemmed Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title_short Molecular characterization of lepotospira isolates from rodents, soil, and water in Sarawak using ERIC-PCR
title_sort molecular characterization of lepotospira isolates from rodents, soil, and water in sarawak using eric-pcr
topic QR Microbiology
url http://ir.unimas.my/id/eprint/15463/
http://ir.unimas.my/id/eprint/15463/3/Intan%20Syahirah.pdf