Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia

Wood formation genes played an important internal factor besides the hormonal aspects in xylogenesis, which control the development of secondary growth in trees. One of the identified enzymes, xyloglucan endotransglycosylase (XET), is discovered to modify intermicrofibrillar xyloglucan chains, a...

Full description

Bibliographic Details
Main Author: Chia, Sze Wooi
Format: Final Year Project Report / IMRAD
Language:English
Published: Universiti Malaysia Sarawak, (UNIMAS) 2005
Subjects:
Online Access:http://ir.unimas.my/id/eprint/1428/
http://ir.unimas.my/id/eprint/1428/8/2013-03-prChiaSWfull.pdf
_version_ 1848834758387171328
author Chia, Sze Wooi
author_facet Chia, Sze Wooi
author_sort Chia, Sze Wooi
building UNIMAS Institutional Repository
collection Online Access
description Wood formation genes played an important internal factor besides the hormonal aspects in xylogenesis, which control the development of secondary growth in trees. One of the identified enzymes, xyloglucan endotransglycosylase (XET), is discovered to modify intermicrofibrillar xyloglucan chains, a major component of primary cell walls in dicots to allow wall-loosening required for plant cell expansion. In this study, Shorea parvifblia Dyer parvifolia obtained from Sarawak Forest Seed Bank was chosen due to its economical value and strong adaptability. The total genomic DNA was extracted using a modified CTAB method. A pair of primers, i. e. forward primer (5' - TGGTGACTCAGCTGGAACAG - 3') and reverse primer (5' - AATCATCGGCATTCCATAGG - 3') was constructed based on the known XFT mRNA sequences obtained from the databases. Polymerase Chain Reaction (PCR) was performed based on the optimized thermo-cycling profile as follow: 35 cycles of I min of denaturing at 94°C, 1 min of annealing at 46°C, and 2 min extension phase at 72°C. A DNA fragment of - -527bp was obtained from the amplification and was cloned using a TA-vector system. Then, the isolated and purified plasmid was sent for sequencing.
first_indexed 2025-11-15T05:57:04Z
format Final Year Project Report / IMRAD
id unimas-1428
institution Universiti Malaysia Sarawak
institution_category Local University
language English
last_indexed 2025-11-15T05:57:04Z
publishDate 2005
publisher Universiti Malaysia Sarawak, (UNIMAS)
recordtype eprints
repository_type Digital Repository
spelling unimas-14282023-02-13T04:16:06Z http://ir.unimas.my/id/eprint/1428/ Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia Chia, Sze Wooi GE Environmental Sciences Wood formation genes played an important internal factor besides the hormonal aspects in xylogenesis, which control the development of secondary growth in trees. One of the identified enzymes, xyloglucan endotransglycosylase (XET), is discovered to modify intermicrofibrillar xyloglucan chains, a major component of primary cell walls in dicots to allow wall-loosening required for plant cell expansion. In this study, Shorea parvifblia Dyer parvifolia obtained from Sarawak Forest Seed Bank was chosen due to its economical value and strong adaptability. The total genomic DNA was extracted using a modified CTAB method. A pair of primers, i. e. forward primer (5' - TGGTGACTCAGCTGGAACAG - 3') and reverse primer (5' - AATCATCGGCATTCCATAGG - 3') was constructed based on the known XFT mRNA sequences obtained from the databases. Polymerase Chain Reaction (PCR) was performed based on the optimized thermo-cycling profile as follow: 35 cycles of I min of denaturing at 94°C, 1 min of annealing at 46°C, and 2 min extension phase at 72°C. A DNA fragment of - -527bp was obtained from the amplification and was cloned using a TA-vector system. Then, the isolated and purified plasmid was sent for sequencing. Universiti Malaysia Sarawak, (UNIMAS) 2005 Final Year Project Report / IMRAD NonPeerReviewed text en http://ir.unimas.my/id/eprint/1428/8/2013-03-prChiaSWfull.pdf Chia, Sze Wooi (2005) Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia. [Final Year Project Report / IMRAD] (Unpublished)
spellingShingle GE Environmental Sciences
Chia, Sze Wooi
Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title_full Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title_fullStr Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title_full_unstemmed Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title_short Isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
title_sort isolation of xet gene involved in wood formation in shorea parvifolia dyer pervioflia
topic GE Environmental Sciences
url http://ir.unimas.my/id/eprint/1428/
http://ir.unimas.my/id/eprint/1428/8/2013-03-prChiaSWfull.pdf